Skip to main content
Addgene
Open Menu

GFP-LacI-p300
(Plasmid #179270)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179270 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 179270-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 179270-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    GFP-LacI-polylinker
  • Backbone size w/o insert (bp) 7304
  • Total vector size (bp) 14469
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB10β cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E1A binding protein p300
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    7242
  • GenBank ID
    NM_001429.1 NG_009817.1
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP-LacI (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Acc65I (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTGAAGGGCAATCAGCTGTT
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-LacI-p300 was a gift from Lienhard Schmitz (Addgene plasmid # 179270 ; http://n2t.net/addgene:179270 ; RRID:Addgene_179270)

  • For your References section:

    Testing the Effect of Histone Acetyltransferases on Local Chromatin Compaction. Pfisterer M, Schmitz ML. Methods Mol Biol. 2023;2589:361-376. doi: 10.1007/978-1-0716-2788-4_24. 10.1007/978-1-0716-2788-4_24 PubMed 36255637
Related items:
Commonly requested with: