GFP-LacI-p300
(Plasmid #179270)

• Purpose: Expresses GFP-LacI-p300 fusion plasmid
• Depositing Lab: Lienhard Schmitz
• Publication: Pfisterer et al Methods Mol Biol. 2023;2589:361-376. doi: 10.1007/978-1-0716-2788-4_24.

Backbone

• Vector backbone: GFP-LacI-polylinker
• Backbone size w/o insert (bp): 7304
• Total vector size (bp): 14469
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB10β cells
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E1A binding protein p300
• Species: H. sapiens (human)
• Insert Size (bp): 7242
• GenBank ID: NM_001429.1 NG_009817.1
• Entrez Gene: EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP-LacI (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Acc65I (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GTGAAGGGCAATCAGCTGTT
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • GFP-LacI-p300.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry