pKAR2-Br512_Mut235
(Plasmid
#179278)
-
PurposeExpresses Br512_Mut235 polymerase in E.coli
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas at Austin
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179278 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepKAR2
-
Backbone manufacturerIn-house made
- Backbone size w/o insert (bp) 5187
- Total vector size (bp) 6218
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEngineered Bst DNA Polymerase I Large Fragment
-
Alt nameBr512g2.2, Br512_Mut235, Mut235
-
SpeciesGeobacillus stearothermophilus
-
Insert Size (bp)1932
-
GenBank ID4O0I_A
- Promoter T7
-
Tag
/ Fusion Protein
- 8x His tag; Villin Headpiece 47 amino acid (HP47) ; Linker (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (unknown if destroyed)
- 3′ cloning site BsaI (unknown if destroyed)
- 5′ sequencing primer CCTATAAAAATAGGCGTATCACGAGGC
- 3′ sequencing primer ACCCGTTTAGAGGCCCCAAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKAR2-Br512_Mut235 was a gift from Andrew Ellington (Addgene plasmid # 179278 ; http://n2t.net/addgene:179278 ; RRID:Addgene_179278) -
For your References section:
Improved Bst DNA Polymerase Variants Derived via a Machine Learning Approach. Paik I, Ngo PHT, Shroff R, Diaz DJ, Maranhao AC, Walker DJF, Bhadra S, Ellington AD. Biochemistry. 2021 Nov 11. doi: 10.1021/acs.biochem.1c00451. 10.1021/acs.biochem.1c00451 PubMed 34762799