Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKAR2-Br512_Mut235
(Plasmid #179278)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179278 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKAR2
  • Backbone manufacturer
    In-house made
  • Backbone size w/o insert (bp) 5187
  • Total vector size (bp) 6218
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Engineered Bst DNA Polymerase I Large Fragment
  • Alt name
    Br512g2.2, Br512_Mut235, Mut235
  • Species
    Geobacillus stearothermophilus
  • Insert Size (bp)
    1932
  • GenBank ID
    4O0I_A
  • Promoter T7
  • Tag / Fusion Protein
    • 8x His tag; Villin Headpiece 47 amino acid (HP47) ; Linker (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (unknown if destroyed)
  • 3′ cloning site BsaI (unknown if destroyed)
  • 5′ sequencing primer CCTATAAAAATAGGCGTATCACGAGGC
  • 3′ sequencing primer ACCCGTTTAGAGGCCCCAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKAR2-Br512_Mut235 was a gift from Andrew Ellington (Addgene plasmid # 179278 ; http://n2t.net/addgene:179278 ; RRID:Addgene_179278)
  • For your References section:

    Improved Bst DNA Polymerase Variants Derived via a Machine Learning Approach. Paik I, Ngo PHT, Shroff R, Diaz DJ, Maranhao AC, Walker DJF, Bhadra S, Ellington AD. Biochemistry. 2021 Nov 11. doi: 10.1021/acs.biochem.1c00451. 10.1021/acs.biochem.1c00451 PubMed 34762799