JEH127
(Plasmid
#179299)
-
PurposeExpresses dCas9 fused to VPR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG-CFP
- Total vector size (bp) 10820
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VPR
-
SpeciesS. Pyogenes
-
Insert Size (bp)5862
-
MutationD10A, H840A (catalytically inactive Cas9)
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer CAGAGGGAAAAAGATCTCAGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JEH127 was a gift from Keith Joung (Addgene plasmid # 179299 ; http://n2t.net/addgene:179299 ; RRID:Addgene_179299) -
For your References section:
Augmenting and directing long-range CRISPR-mediated activation in human cells. Tak YE, Horng JE, Perry NT, Schultz HT, Iyer S, Yao Q, Zou LS, Aryee MJ, Pinello L, Joung JK. Nat Methods. 2021 Sep;18(9):1075-1081. doi: 10.1038/s41592-021-01224-1. Epub 2021 Aug 5. 10.1038/s41592-021-01224-1 PubMed 34354266