Skip to main content

pEGFP-hCB2R
(Plasmid #179322)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179322 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Total vector size (bp) 5781
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human cannabinoid 2 receptor
  • Alt name
    CB2R
  • Alt name
    CNR2
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001841.3 1269
  • Entrez Gene
    CNR2 (a.k.a. CB-2, CB2, CX5)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer ACTTGTGGCCGTTTACGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-hCB2R was a gift from Christian Gruber (Addgene plasmid # 179322 ; http://n2t.net/addgene:179322 ; RRID:Addgene_179322)
  • For your References section:

    Discovery and development of macrocyclic peptide modulators of the cannabinoid 2 receptor. Tomašević N, Emser FS, Muratspahic E, Gattringer J, Hasinger S, Hellinger R, Keov P, Felkl M, Gertsch J, Becker CFW, Gruber CW. J Biol Chem. 2024 Jun;300(6):107330. doi: 10.1016/j.jbc.2024.107330. Epub 2024 Apr 26. 10.1016/j.jbc.2024.107330 PubMed 38679329