pHybrid-Electra1
(Plasmid
#179474)
-
PurposeExpresses Electra1 in bacterial cells and Electra1 and mScarlet in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHybrid
- Backbone size w/o insert (bp) 4895
- Total vector size (bp) 5609
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameElectra1
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)714
-
GenBank IDOL631606
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAGAATTCACGCGTGGTACCAGCCACCATGGTGTCTAAGGGCGAAGAGC
- 3′ sequencing primer GATGCCTGGGTCGACTCTAGATTACTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemScarlet-I
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)696
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHybrid-Electra1 was a gift from Kiryl Piatkevich (Addgene plasmid # 179474 ; http://n2t.net/addgene:179474 ; RRID:Addgene_179474) -
For your References section:
Dual-expression system for blue fluorescent protein optimization. Papadaki S, Wang X, Wang Y, Zhang H, Jia S, Liu S, Yang M, Zhang D, Jia JM, Koster RW, Namikawa K, Piatkevich KD. Sci Rep. 2022 Jun 17;12(1):10190. doi: 10.1038/s41598-022-13214-0. 10.1038/s41598-022-13214-0 PubMed 35715437