pPaxillin-Electra1-N1
(Plasmid
#179484)
-
PurposeExpresses paxillin fused to blue fluorescent protein Electra1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3933
- Total vector size (bp) 6390
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepaxillin-Electra1
-
SpeciesG. gallus (chicken), Synthetic
-
Insert Size (bp)2457
-
GenBank IDOL631606
- Promoter CMV
-
Tag
/ Fusion Protein
- Electra1 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Excitation:403nm, Emission:456nm
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPaxillin-Electra1-N1 was a gift from Kiryl Piatkevich (Addgene plasmid # 179484 ; http://n2t.net/addgene:179484 ; RRID:Addgene_179484) -
For your References section:
Dual-expression system for blue fluorescent protein optimization. Papadaki S, Wang X, Wang Y, Zhang H, Jia S, Liu S, Yang M, Zhang D, Jia JM, Koster RW, Namikawa K, Piatkevich KD. Sci Rep. 2022 Jun 17;12(1):10190. doi: 10.1038/s41598-022-13214-0. 10.1038/s41598-022-13214-0 PubMed 35715437