pAID1.2-EF1a-NmClover3-hsLem2
(Plasmid
#179524)
-
PurposeExpress OsTIR1 and mClover3-mAID-hsLem2 in mammalian cells under the control of EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAID1.2-EF1a-NmClover3
- Backbone size w/o insert (bp) 7371
- Total vector size (bp) 8883
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLEMD2
-
SpeciesH. sapiens (human)
-
GenBank IDNM_181336.4
-
Entrez GeneLEMD2 (a.k.a. CTRCT42, LEM2, NET25, dJ482C21.1)
- Promoter EF1α
-
Tag
/ Fusion Protein
- mClover3-mAID (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGCGACGGCCCCGTGCTGC
- 3′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAID1.2-EF1a-NmClover3-hsLem2 was a gift from Yasushi Hiraoka (Addgene plasmid # 179524 ; http://n2t.net/addgene:179524 ; RRID:Addgene_179524) -
For your References section:
Transfected plasmid DNA is incorporated into the nucleus via nuclear envelope reformation at telophase. Haraguchi T, Koujin T, Shindo T, Bilir S, Osakada H, Nishimura K, Hirano Y, Asakawa H, Mori C, Kobayashi S, Okada Y, Chikashige Y, Fukagawa T, Shibata S, Hiraoka Y. Commun Biol. 2022 Jan 20;5(1):78. doi: 10.1038/s42003-022-03021-8. 10.1038/s42003-022-03021-8 PubMed 35058555