ePB-Bsd-CAG-LoxP-dsRed_PA-LoxP-SV40-NLS-NG-T2A-hSHH
(Plasmid
#179586)
-
PurposeePiggyBac vector that has a blasticidin selectable cassette and a LoxP exchangeable dual colors cassette with SHH expression (Red module-dsRed/Green module-NeonGreen T2A SHH)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneKS(-)
-
Vector typepiggyBac
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-NG-T2A-hSHH
-
SpeciesH. sapiens (human)
- Promoter TRE
-
Tag
/ Fusion Protein
- NeonGreen (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer gttattcgagtctagaggacc
- 3′ sequencing primer gttaacaacaacaattgcattc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ePB-Bsd-CAG-LoxP-dsRed_PA-LoxP-SV40-NLS-NG-T2A-hSHH was a gift from Ali Hemmati Brivanlou (Addgene plasmid # 179586 ; http://n2t.net/addgene:179586 ; RRID:Addgene_179586) -
For your References section:
Self-organization of human dorsal-ventral forebrain structures by light induced SHH. De Santis R, Etoc F, Rosado-Olivieri EA, Brivanlou AH. Nat Commun. 2021 Nov 19;12(1):6768. doi: 10.1038/s41467-021-26881-w. 10.1038/s41467-021-26881-w PubMed 34799555