pF(UG) U6-SYT7 sgRNA 777 HaloTag
(Plasmid
#179724)
-
PurposeU6-driven SYT7 gRNA and HaloTag lentiviral vector for CRISPR/HITI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179724 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePFUGW
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA and HaloTag
-
gRNA/shRNA sequencecaccagctgaaagcctgaga
-
SpeciesOther
Cloning Information
- Cloning method Ligation Independent Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF(UG) U6-SYT7 sgRNA 777 HaloTag was a gift from Edwin Chapman (Addgene plasmid # 179724 ; http://n2t.net/addgene:179724 ; RRID:Addgene_179724) -
For your References section:
Synaptotagmin 7 is targeted to the axonal plasma membrane through gamma-secretase processing to promote synaptic vesicle docking in mouse hippocampal neurons. Vevea JD, Kusick GF, Courtney KC, Chen E, Watanabe S, Chapman ER. Elife. 2021 Sep 20;10. pii: 67261. doi: 10.7554/eLife.67261. 10.7554/eLife.67261 PubMed 34543184