Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pF(UG) U6-SYT7 sgRNA 777 HaloTag
(Plasmid #179724)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179724 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PFUGW
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA and HaloTag
  • gRNA/shRNA sequence
    caccagctgaaagcctgaga
  • Species
    Other

Cloning Information

  • Cloning method Ligation Independent Cloning

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF(UG) U6-SYT7 sgRNA 777 HaloTag was a gift from Edwin Chapman (Addgene plasmid # 179724 ; http://n2t.net/addgene:179724 ; RRID:Addgene_179724)
  • For your References section:

    Synaptotagmin 7 is targeted to the axonal plasma membrane through gamma-secretase processing to promote synaptic vesicle docking in mouse hippocampal neurons. Vevea JD, Kusick GF, Courtney KC, Chen E, Watanabe S, Chapman ER. Elife. 2021 Sep 20;10. pii: 67261. doi: 10.7554/eLife.67261. 10.7554/eLife.67261 PubMed 34543184