pCDH-AtAFB2-mTagBFP2
(Plasmid
#179889)
-
PurposeExpresses AtAFB2 (auxin-inducible degron system) fused to mTagBFP2 (lentiviral plasmid)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH
-
Backbone manufacturerSystembio
- Backbone size w/o insert (bp) 6390
- Total vector size (bp) 8840
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersmTagBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtAFB2
-
Alt nameAFB2
-
Alt nameAT3G26810
-
Alt nameauxin signaling F-box 2
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)2450
-
GenBank IDMP787830.1
-
Entrez GeneAFB2 (a.k.a. AT3G26810, auxin signaling F-box 2)
- Promoter EF1
-
Tag
/ Fusion Protein
- mTagBFP2 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCCACGCTTTGCCTGACCCTGCTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This lentiviral plasmids delivers AtAFB2 (auxin-inducible degron system) fused to mTagBFP2. In combination with TetOn3G can be used to generate DExogron = DExCon (Doxycycline-mediated endogenous gene Expression Control) combined with auxin-mediated targeted protein degradation.
Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-AtAFB2-mTagBFP2 was a gift from Patrick Caswell (Addgene plasmid # 179889 ; http://n2t.net/addgene:179889 ; RRID:Addgene_179889) -
For your References section:
On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members. Gemperle J, Harrison TS, Flett C, Adamson AD, Caswell PT. Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651. 10.7554/eLife.76651 PubMed 35708998