Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJET-42-DExCon-antiGFPnanobody-mCherry-R11a
(Plasmid #179902)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179902 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 5155
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR ; Donor for homologous based knock in
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RAB11A, member RAS oncogene family
  • Alt name
    YL8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2181
  • Entrez Gene
    RAB11A (a.k.a. YL8)
  • Promoter TRE3GS
  • Tag / Fusion Protein
    • antiGFPnanobody-mCherry (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCG
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Here donor for DExCon Rab11a knock in. DExCon = Doxycycline-mediated endogenous gene Expression Control. Lentiviral delivery of TetOn 3G is also required for this to work.

AntiGFPnanobody can be used to manipulate with endogenously expressed protein.
https://figshare.com/projects/DExCon_DExogron_LUXon_on-demand_expression_control_of_endogenous_genes_reveals_differential_dynamics_of_Rab11_family_members/118281.

Please visit https://www.biorxiv.org/content/10.1101/2021.12.03.471086v1.full for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET-42-DExCon-antiGFPnanobody-mCherry-R11a was a gift from Patrick Caswell (Addgene plasmid # 179902 ; http://n2t.net/addgene:179902 ; RRID:Addgene_179902)
  • For your References section:

    On demand expression control of endogenous genes with DExCon, DExogron and LUXon reveals differential dynamics of Rab11 family members. Gemperle J, Harrison TS, Flett C, Adamson AD, Caswell PT. Elife. 2022 Jun 16;11. pii: 76651. doi: 10.7554/eLife.76651. 10.7554/eLife.76651 PubMed 35708998