Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-Bcl2-Maob
(Plasmid #18001)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18001 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEMD-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mitochondria-targeted Bcl-2
  • Alt name
    Bcl-2 Maob
  • Alt name
    Bcl-2 Monoamine oxidase B
  • Alt name
    Bcl-2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    746
  • Mutation
    Bcl-2's C terminal replaced with mitochondria-targeted sequence (LLRLIGLTTIFSATALGFLAHKRGLLVRV)
  • Entrez Gene
    BCL2 (a.k.a. Bcl-2, PPP1R50)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site Sal I (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    PCR amplified Bcl-2 from pB4 plasmid purchased from ATCC. PCR amplified Maob from EST purchased from Genome Systems
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Bcl2-Maob was a gift from Clark Distelhorst (Addgene plasmid # 18001 ; http://n2t.net/addgene:18001 ; RRID:Addgene_18001)
  • For your References section:

    Transient expression of wild-type or mitochondrially targeted Bcl-2 induces apoptosis, whereas transient expression of endoplasmic reticulum-targeted Bcl-2 is protective against Bax-induced cell death. Wang NS, Unkila MT, Reineks EZ, Distelhorst CW. J Biol Chem. 2001 Nov 23. 276(47):44117-28. 10.1074/jbc.M101958200 PubMed 11546793