-
Depositing Lab
-
Depositing OrganizationCase Western Reserve University
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 18001 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 18001-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 18001-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEMD-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMitochondria-targeted Bcl-2
-
Alt nameBcl-2 Maob
-
Alt nameBcl-2 Monoamine oxidase B
-
Alt nameBcl-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)746
-
MutationBcl-2's C terminal replaced with mitochondria-targeted sequence (LLRLIGLTTIFSATALGFLAHKRGLLVRV)
-
Entrez GeneBCL2 (a.k.a. Bcl-2, PPP1R50)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPCR amplified Bcl-2 from pB4 plasmid purchased from ATCC. PCR amplified Maob from EST purchased from Genome Systems
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 18001-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 18001-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Bcl2-Maob was a gift from Clark Distelhorst (Addgene plasmid # 18001 ; http://n2t.net/addgene:18001 ; RRID:Addgene_18001) -
For your References section:
Transient expression of wild-type or mitochondrially targeted Bcl-2 induces apoptosis, whereas transient expression of endoplasmic reticulum-targeted Bcl-2 is protective against Bax-induced cell death. Wang NS, Unkila MT, Reineks EZ, Distelhorst CW. J Biol Chem. 2001 Nov 23. 276(47):44117-28. 10.1074/jbc.M101958200 PubMed 11546793
Map uploaded by the depositor.
