pENTR1A-PIK3CA E545K
(Plasmid
#180032)
-
PurposeEntry vector of PIK3CA E545K for gateway cloning.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepENTR1A
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 2700
-
Vector typeMammalian Expression ; Entry Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePIK3CA E545K
-
Alt namephosphoinositide 3-kinase
-
Alt namePI3K
-
Alt namep110 alpha
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3207
-
MutationE545K
-
GenBank IDNM_006218.4
-
Entrez GenePIK3CA (a.k.a. CCM4, CLAPO, CLOVE, CWS5, HMH, MCAP, MCM, MCMTC, PI3K, PI3K-alpha, p110-alpha)
-
Tag
/ Fusion Protein
- HA tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTA
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHA-PIK3CA E545K was cloned from Addgene #12525: pBabe-HA-PIK3CA E545K
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR1A-PIK3CA E545K was a gift from Xin Chen (Addgene plasmid # 180032 ; http://n2t.net/addgene:180032 ; RRID:Addgene_180032) -
For your References section:
Activated mutant forms of PIK3CA cooperate with RasV12 or c-Met to induce liver tumor formation in mice via AKT2/mTORC1 cascade. Wang C, Che L, Hu J, Zhang S, Jiang L, Latte G, Demartis MI, Tao J, Gui B, Pilo MG, Ribback S, Dombrowski F, Evert M, Calvisi DF, Chen X. Liver Int. 2015 Dec 30. doi: 10.1111/liv.13055. 10.1111/liv.13055 PubMed 26716908