Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pENTR1A-PIK3CA E545K
(Plasmid #180032)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180032 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR1A
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 2700
  • Vector type
    Mammalian Expression ; Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PIK3CA E545K
  • Alt name
    phosphoinositide 3-kinase
  • Alt name
    PI3K
  • Alt name
    p110 alpha
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3207
  • Mutation
    E545K
  • GenBank ID
    NM_006218.4
  • Entrez Gene
    PIK3CA (a.k.a. CCM4, CLAPO, CLOVE, CWS5, HMH, MCAP, MCM, MCMTC, PI3K, PI3K-alpha, p110-alpha)
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTA
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    HA-PIK3CA E545K was cloned from Addgene #12525: pBabe-HA-PIK3CA E545K

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR1A-PIK3CA E545K was a gift from Xin Chen (Addgene plasmid # 180032 ; http://n2t.net/addgene:180032 ; RRID:Addgene_180032)
  • For your References section:

    Activated mutant forms of PIK3CA cooperate with RasV12 or c-Met to induce liver tumor formation in mice via AKT2/mTORC1 cascade. Wang C, Che L, Hu J, Zhang S, Jiang L, Latte G, Demartis MI, Tao J, Gui B, Pilo MG, Ribback S, Dombrowski F, Evert M, Calvisi DF, Chen X. Liver Int. 2015 Dec 30. doi: 10.1111/liv.13055. 10.1111/liv.13055 PubMed 26716908