-
Purpose(Empty Backbone) Cloning vector for expressing circular RNA from a U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Backbone manufacturerCustom
- Backbone size (bp) 6000
-
Modifications to backbone6300
-
Vector typeMammalian Expression, AAV
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Digest vector with AgeI+NheI to clone any sequence between the ribozymes
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Circular guide cloning vector was a gift from Prashant Mali (Addgene plasmid # 180184 ; http://n2t.net/addgene:180184 ; RRID:Addgene_180184) -
For your References section:
Efficient in vitro and in vivo RNA editing via recruitment of endogenous ADARs using circular guide RNAs. Katrekar D, Yen J, Xiang Y, Saha A, Meluzzi D, Savva Y, Mali P. Nat Biotechnol. 2022 Feb 10. pii: 10.1038/s41587-021-01171-4. doi: 10.1038/s41587-021-01171-4. 10.1038/s41587-021-01171-4 PubMed 35145312