Skip to main content
Addgene

ET8-GPIba-high-6His
(Plasmid #180251)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180251 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ET8
  • Backbone size w/o insert (bp) 5341
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human GPIbalpha 1-290aa with mutation G233V and M239V
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    903
  • Mutation
    G233V and M239V
  • Entrez Gene
    GP1BA (a.k.a. BDPLT1, BDPLT3, BSS, CD42B, CD42b-alpha, DBPLT3, GP1B, GPIbA, GPIbalpha, VWDP)
  • Tag / Fusion Protein
    • 6His (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer TCTCGACACCCTTCTCCTCCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ET8-GPIba-high-6His was a gift from Timothy Springer (Addgene plasmid # 180251 ; http://n2t.net/addgene:180251 ; RRID:Addgene_180251)
  • For your References section:

    Electrostatic Steering Enables Flow-Activated Von Willebrand Factor to Bind Platelet Glycoprotein, Revealed by Single-Molecule Stretching and Imaging. Jiang Y, Fu H, Springer TA, Wong WP. J Mol Biol. 2019 Mar 29;431(7):1380-1396. doi: 10.1016/j.jmb.2019.02.014. Epub 2019 Feb 22. 10.1016/j.jmb.2019.02.014 PubMed 30797858