ET8-GPIba-high-6His
(Plasmid
#180251)
-
PurposeHigh affinity mutant of human platelet membrane protein GP1b alpha
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneET8
- Backbone size w/o insert (bp) 5341
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman GPIbalpha 1-290aa with mutation G233V and M239V
-
SpeciesH. sapiens (human)
-
Insert Size (bp)903
-
MutationG233V and M239V
-
Entrez GeneGP1BA (a.k.a. BDPLT1, BDPLT3, BSS, CD42B, CD42b-alpha, DBPLT3, GP1B, GPIbA, GPIbalpha, VWDP)
-
Tag
/ Fusion Protein
- 6His (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV Forward
- 3′ sequencing primer TCTCGACACCCTTCTCCTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ET8-GPIba-high-6His was a gift from Timothy Springer (Addgene plasmid # 180251 ; http://n2t.net/addgene:180251 ; RRID:Addgene_180251) -
For your References section:
Electrostatic Steering Enables Flow-Activated Von Willebrand Factor to Bind Platelet Glycoprotein, Revealed by Single-Molecule Stretching and Imaging. Jiang Y, Fu H, Springer TA, Wong WP. J Mol Biol. 2019 Mar 29;431(7):1380-1396. doi: 10.1016/j.jmb.2019.02.014. Epub 2019 Feb 22. 10.1016/j.jmb.2019.02.014 PubMed 30797858