-
PurposeLentiviral expression vector for dCas9-VP64 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPRv2
- Total vector size (bp) 13123
-
Modifications to backboneThe promoter was switched to SFFV, an mCherry-P2A was introduced upstream of dCas9-VP64, and the sgRNA cassette was removed.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9
-
SpeciesS. Pyogenes
-
MutationNuclease dead Cas9
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccaatcagcctgcttctcgc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9-VP64 originated from lentiSAMv2 (Addgene #75112) and cloned into the lentiCRISPRv2-dCas9 backbone (Addgene #112233).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZR112_Lenti-SFFV-mCherry-2A-dCas9-VP64 was a gift from Alexander Marson (Addgene plasmid # 180263 ; http://n2t.net/addgene:180263 ; RRID:Addgene_180263) -
For your References section:
CRISPR activation and interference screens decode stimulation responses in primary human T cells. Schmidt R, Steinhart Z, Layeghi M, Freimer JW, Bueno R, Nguyen VQ, Blaeschke F, Ye CJ, Marson A. Science. 2022 Feb 4;375(6580):eabj4008. doi: 10.1126/science.abj4008. Epub 2022 Feb 4. 10.1126/science.abj4008 PubMed 35113687