Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pZR064_CROPseq-sgCD4-CRISPRi
(Plasmid #180270)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180270 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CROPseq-Guide-Puro
  • Total vector size (bp) 8364
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD4 sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgatt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CROPseq-Guide-Puro was a gift from Christoph Bock (Addgene plasmid # 86708)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZR064_CROPseq-sgCD4-CRISPRi was a gift from Alexander Marson (Addgene plasmid # 180270 ; http://n2t.net/addgene:180270 ; RRID:Addgene_180270)
  • For your References section:

    CRISPR activation and interference screens decode stimulation responses in primary human T cells. Schmidt R, Steinhart Z, Layeghi M, Freimer JW, Bueno R, Nguyen VQ, Blaeschke F, Ye CJ, Marson A. Science. 2022 Feb 4;375(6580):eabj4008. doi: 10.1126/science.abj4008. Epub 2022 Feb 4. 10.1126/science.abj4008 PubMed 35113687