pCasper-pNos-PCP-eGFP
(Plasmid
#180274)
-
Purposeto epress PCP-GFP fusion protein in the early fly embryos (driven by maternal nanos driver)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCasper
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 10830
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCP-eGFP
-
Alt namePCP-eGFP
-
Insert Size (bp)2700
-
GenBank ID
- Promoter nanos
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAATACTTCAGTTGAATAAACTGTGCTTG
- 3′ sequencing primer GCCACTTCAACGCTCGATGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCasper-pNos-PCP-eGFP was a gift from Hernan Garcia (Addgene plasmid # 180274 ; http://n2t.net/addgene:180274 ; RRID:Addgene_180274) -
For your References section:
Real-time single-cell characterization of the eukaryotic transcription cycle reveals correlations between RNA initiation, elongation, and cleavage. Liu J, Hansen D, Eck E, Kim YJ, Turner M, Alamos S, Garcia HG. PLoS Comput Biol. 2021 May 18;17(5):e1008999. doi: 10.1371/journal.pcbi.1008999. eCollection 2021 May. 10.1371/journal.pcbi.1008999 PubMed 34003867