Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYTK-DN4
(Plasmid #180285)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYTK084
  • Backbone size w/o insert (bp) 1779
  • Total vector size (bp) 5083
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    geneticin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ConLS' - GFP - ConRE' - KanR - CEN6/ARS4
  • Species
    Synthetic
  • Insert Size (bp)
    3304

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gaattcgcatctagactgatg
  • 3′ sequencing primer gacggatcgcttgcctgtaac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    A Highly-characterized Yeast Toolkit for Modular, Multi-part Assembly. Lee ME, DeLoache, WC A, Cervantes B, Dueber, JE. ACS Synthetic Biology 2015 DOI: 10.1021/sb500366v

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was obtained via Golden Gate assembly of plasmids: pYTK008 + pYTK047 + pYTK073 + pYTK077 + pYTK081 + pYTK084

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYTK-DN4 was a gift from Andreas Milias-Argeitis (Addgene plasmid # 180285 ; http://n2t.net/addgene:180285 ; RRID:Addgene_180285)
  • For your References section:

    A user-friendly and streamlined protocol for CRISPR/Cas9 genome editing in budding yeast. Novarina D, Koutsoumpa A, Milias-Argeitis A. STAR Protoc. 2022 Jun 10;3(2):101358. doi: 10.1016/j.xpro.2022.101358. eCollection 2022 Jun 17. 10.1016/j.xpro.2022.101358 PubMed 35712010