Skip to main content

W118-1_hZBTB7B_R363L
(Plasmid #180381)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180381 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    W118-1
  • Backbone size w/o insert (bp) 8015
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ZBTB7B_R363L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1620
  • Mutation
    R363L
  • Entrez Gene
    ZBTB7B (a.k.a. CKROX, THPOK, ZBTB15, ZFP-67, ZFP67, ZNF857B, c-KROX, hcKROX, vGAF)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CMV forward
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    W118-1_hZBTB7B_R363L was a gift from Huda Zoghbi (Addgene plasmid # 180381 ; http://n2t.net/addgene:180381 ; RRID:Addgene_180381)
  • For your References section:

    Dual targeting of brain region-specific kinases potentiates neurological rescue in Spinocerebellar ataxia type 1. Lee WS, Lavery L, Rousseaux MWC, Rutledge EB, Jang Y, Wan YW, Wu SR, Kim W, Al-Ramahi I, Rath S, Adamski CJ, Bondar VV, Tewari A, Soleimani S, Mota S, Yalamanchili HK, Orr HT, Liu Z, Botas J, Zoghbi HY. EMBO J. 2021 Apr 1;40(7):e106106. doi: 10.15252/embj.2020106106. Epub 2021 Mar 11. 10.15252/embj.2020106106 PubMed 33709453