pCAT527
(Plasmid
#180514)
-
PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, mNeonGreen, sgRNAv2 scaffold, and restriction sites to clone in new spacers
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBLO62.5
- Backbone size w/o insert (bp) 4847
- Total vector size (bp) 8683
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCasX sgRNAv2
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTGTTAGAGAGATAATTGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePlmCasX with DpbCasX R1 loop-2A-mNeonGreen
-
Alt namePlmCas12e
-
SpeciesPlanctomycetes, Deltaproteobacteria
- Promoter CAG
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
- 2x FLAG (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGTTTAAGGGATGGTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAT527 was a gift from Jennifer Doudna (Addgene plasmid # 180514 ; http://n2t.net/addgene:180514 ; RRID:Addgene_180514) -
For your References section:
Chimeric CRISPR-CasX enzymes and guide RNAs for improved genome editing activity. Tsuchida CA, Zhang S, Doost MS, Zhao Y, Wang J, O'Brien E, Fang H, Li CP, Li D, Hai ZY, Chuck J, Brotzmann J, Vartoumian A, Burstein D, Chen XW, Nogales E, Doudna JA, Liu JG. Mol Cell. 2022 Mar 17;82(6):1199-1209.e6. doi: 10.1016/j.molcel.2022.02.002. Epub 2022 Feb 25. 10.1016/j.molcel.2022.02.002 PubMed 35219382