Phage-PGK-Flag-HA-FKBP-T(WT)
(Plasmid
#181734)
-
Purposefor lentiviral expression of brachyury ORF in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonePhage-PGK-Flag-HA-FKBP-DEST
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT (brachyury)
-
SpeciesH. sapiens (human)
-
Mutationa silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine
Cloning Information
- Cloning method Gateway Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Phage-PGK-Flag-HA-FKBP-T(WT) was a gift from Charles Lin (Addgene plasmid # 181734 ; http://n2t.net/addgene:181734 ; RRID:Addgene_181734) -
For your References section:
Targeted brachyury degradation disrupts a highly specific autoregulatory program controlling chordoma cell identity. Sheppard HE, Dall'Agnese A, Park WD, Shamim MH, Dubrulle J, Johnson HL, Stossi F, Cogswell P, Sommer J, Levy J, Sharifnia T, Wawer MJ, Nabet B, Gray NS, Clemons PA, Schreiber SL, Workman P, Young RA, Lin CY. Cell Rep Med. 2021 Jan 19;2(1):100188. doi: 10.1016/j.xcrm.2020.100188. eCollection 2021 Jan 19. 10.1016/j.xcrm.2020.100188 PubMed 33521702