Skip to main content

Phage-PGK-Flag-HA-FKBP-T(WT)
(Plasmid #181734)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 181734 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    Phage-PGK-Flag-HA-FKBP-DEST
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    T (brachyury)
  • Species
    H. sapiens (human)
  • Mutation
    a silent mutation in the PAM site of an sgRNAt targeting enodgenous T (sg_T: CCCTGAGACCCAGTTCATAG) at amino acid 194 - C to T at position 3 of alanine

Cloning Information

  • Cloning method Gateway Cloning

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Phage-PGK-Flag-HA-FKBP-T(WT) was a gift from Charles Lin (Addgene plasmid # 181734 ; http://n2t.net/addgene:181734 ; RRID:Addgene_181734)
  • For your References section:

    Targeted brachyury degradation disrupts a highly specific autoregulatory program controlling chordoma cell identity. Sheppard HE, Dall'Agnese A, Park WD, Shamim MH, Dubrulle J, Johnson HL, Stossi F, Cogswell P, Sommer J, Levy J, Sharifnia T, Wawer MJ, Nabet B, Gray NS, Clemons PA, Schreiber SL, Workman P, Young RA, Lin CY. Cell Rep Med. 2021 Jan 19;2(1):100188. doi: 10.1016/j.xcrm.2020.100188. eCollection 2021 Jan 19. 10.1016/j.xcrm.2020.100188 PubMed 33521702