Skip to main content

pAAV-EGFP.T2A.NCLX.3'UTR
(Plasmid #181872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181872 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-CAG
  • Vector type
    Mammalian Expression, Adenoviral, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    solute carrier family 8 member B1
  • Alt name
    NCLX
  • Alt name
    sodium/calcium/lithium exchanger
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1755
  • Mutation
    includes a large portion of the Slc8b1 3'UTR downstream of the CDS
  • GenBank ID
    NM_133221
  • Entrez Gene
    Slc8b1 (a.k.a. AF261233, NCKX6, NCLX, Slc24a6)
  • Promoter synthetic hybrid CAG promoter
  • Tag / Fusion Protein
    • myc (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer ACGGGAAGCAATAGCATGATAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Alt name
    enhanced GFP
  • Insert Size (bp)
    717
  • Promoter synthetic hybrid CAG promoter
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • T2A (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    3'UTR of solute carrier family 8 member B1
  • Alt name
    NCLX 3'UTR
  • Alt name
    sodium/calcium/lithium exchanger 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    774
  • Mutation
    the last 212 nucleotides of the 3'UTR are not included in the sequence
  • GenBank ID
    NM_133221
  • Promoter synthetic hybrid CAG promoter

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer ACGGGAAGCAATAGCATGATAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Israel Sekler, Department of Physiology and Cell Biology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EGFP.T2A.NCLX.3'UTR was a gift from Hilmar Bading (Addgene plasmid # 181872 ; http://n2t.net/addgene:181872 ; RRID:Addgene_181872)
  • For your References section:

    Disrupted expression of mitochondrial NCLX sensitizes neuroglial networks to excitotoxic stimuli and renders synaptic activity toxic. Hagenston AM, Yan J, Bas-Orth C, Tan Y, Sekler I, Bading H. J Biol Chem. 2021 Dec 20:101508. doi: 10.1016/j.jbc.2021.101508. 10.1016/j.jbc.2021.101508 PubMed 34942149