pAAV-shCTRL
(Plasmid
#181875)
-
PurposeExpresses a control shRNA with no known targets in the mouse genome under control of the U6 promoter and mCherry under control of the CaMKIIa promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-U6_CaMKIIa-mCherry
-
Vector typeMammalian Expression, Mouse Targeting, Adenoviral, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecontrol shRNA with no known targets in the mouse genome
-
Alt nameshCTRL
-
gRNA/shRNA sequence000_pACKH5
-
SpeciesM. musculus (mouse)
- Promoter U6
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer TTGGGTAGTTTGCAGTTTTAAAATT
- 3′ sequencing primer TCACTGAGGAAGCTCTCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-shCTRL was a gift from Hilmar Bading (Addgene plasmid # 181875 ; http://n2t.net/addgene:181875 ; RRID:Addgene_181875) -
For your References section:
Disrupted expression of mitochondrial NCLX sensitizes neuroglial networks to excitotoxic stimuli and renders synaptic activity toxic. Hagenston AM, Yan J, Bas-Orth C, Tan Y, Sekler I, Bading H. J Biol Chem. 2021 Dec 20:101508. doi: 10.1016/j.jbc.2021.101508. 10.1016/j.jbc.2021.101508 PubMed 34942149