Skip to main content

psgRNA-2xMS2-mSAT
(Plasmid #181908)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181908 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pU6_sgRNA-MS2-backbone
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 3008
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA-2XMS2-mSAT
  • gRNA/shRNA sequence
    GGGCAAGAAAACTGAAAATCA
  • Species
    S.pyogenes, MS2 bacteriophage, M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psgRNA-2xMS2-mSAT was a gift from Karsten Rippe (Addgene plasmid # 181908 ; http://n2t.net/addgene:181908 ; RRID:Addgene_181908)
  • For your References section:

    Mouse Heterochromatin Adopts Digital Compaction States without Showing Hallmarks of HP1-Driven Liquid-Liquid Phase Separation. Erdel F, Rademacher A, Vlijm R, Tunnermann J, Frank L, Weinmann R, Schweigert E, Yserentant K, Hummert J, Bauer C, Schumacher S, Al Alwash A, Normand C, Herten DP, Engelhardt J, Rippe K. Mol Cell. 2020 Apr 16;78(2):236-249.e7. doi: 10.1016/j.molcel.2020.02.005. Epub 2020 Feb 25. 10.1016/j.molcel.2020.02.005 PubMed 32101700