psgRNA-2xMS2-mSAT
(Plasmid
#181908)
-
PurposeSingle guide RNA with 2XMS2 loops targeting mouse major satellite repeats
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6_sgRNA-MS2-backbone
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 3008
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-2XMS2-mSAT
-
gRNA/shRNA sequenceGGGCAAGAAAACTGAAAATCA
-
SpeciesS.pyogenes, MS2 bacteriophage, M. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psgRNA-2xMS2-mSAT was a gift from Karsten Rippe (Addgene plasmid # 181908 ; http://n2t.net/addgene:181908 ; RRID:Addgene_181908) -
For your References section:
Mouse Heterochromatin Adopts Digital Compaction States without Showing Hallmarks of HP1-Driven Liquid-Liquid Phase Separation. Erdel F, Rademacher A, Vlijm R, Tunnermann J, Frank L, Weinmann R, Schweigert E, Yserentant K, Hummert J, Bauer C, Schumacher S, Al Alwash A, Normand C, Herten DP, Engelhardt J, Rippe K. Mol Cell. 2020 Apr 16;78(2):236-249.e7. doi: 10.1016/j.molcel.2020.02.005. Epub 2020 Feb 25. 10.1016/j.molcel.2020.02.005 PubMed 32101700