Skip to main content

pCW57.1_SPTLC1_WT
(Plasmid #181920)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181920 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    Addgene Plasmid #41393
  • Backbone size w/o insert (bp) 9354
  • Total vector size (bp) 9057
  • Vector type
    Mammalian Expression, Lentiviral ; Mammalian expression, , Doxycycline inducible
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Human serine palmitoyltransferase, long chain base subunit 1 (SPTLC1),
  • Alt name
    SPTLC1
  • Alt name
    Also known as HSN1; LBC1; LCB1; SPT1; SPTI; HSAN1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1420
  • GenBank ID
    Gene ID: 10558 NM_006415
  • Entrez Gene
    SPTLC1 (a.k.a. HSAN1, HSN1, LBC1, LCB1, SPT1, SPTI)
  • Promoter tight TRE promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NHeI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer TGAAACGCCGAGTTACACGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1_SPTLC1_WT was a gift from Christian Metallo (Addgene plasmid # 181920 ; http://n2t.net/addgene:181920 ; RRID:Addgene_181920)
  • For your References section:

    1-deoxysphingolipid synthesis compromises anchorage-independent growth and plasma membrane endocytosis in cancer cells. Cordes T, Kuna RS, McGregor GH, Khare SV, Gengatharan J, Muthusamy T, Metallo CM. J Lipid Res. 2022 Sep 14:100281. doi: 10.1016/j.jlr.2022.100281. 10.1016/j.jlr.2022.100281 PubMed 36115594