-
PurposeExpress AirID in mammalian cells.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAGIA-AirID
-
SpeciesSynthetic
-
Insert Size (bp)981
-
Tag
/ Fusion Protein
- AGIA-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_AGIA-AirID was a gift from Sohei Ito & Shogo Nakano & Akira Nozawa & Tatsuya Sawasaki (Addgene plasmid # 182210 ; http://n2t.net/addgene:182210 ; RRID:Addgene_182210) -
For your References section:
AirID, a novel proximity biotinylation enzyme, for analysis of protein-protein interactions. Kido K, Yamanaka S, Nakano S, Motani K, Shinohara S, Nozawa A, Kosako H, Ito S, Sawasaki T. Elife. 2020 May 11;9. pii: 54983. doi: 10.7554/eLife.54983. 10.7554/eLife.54983 PubMed 32391793