pCSC-LHX8-IRES-GBX1
(Plasmid
#182235)
-
PurposeTo convert human skin fibroblasts into induced basal forebrain cholinergic neurons (hiBFCNs) in combination with ASCL1, Sox11, FGF2 and two small molecules, forskolin and LDN-193189
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182235 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCSC-SP-PW-IRES-GFP
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer agctcgtttagtgaaccgtcagatc
- 3′ sequencing primer gagcaacatagttaagaataccag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSC-LHX8-IRES-GBX1 was a gift from Chun-Li Zhang (Addgene plasmid # 182235 ; http://n2t.net/addgene:182235 ; RRID:Addgene_182235) -
For your References section:
Aging-relevant human basal forebrain cholinergic neurons as a cell model for Alzheimer's disease. Ma S, Zang T, Liu ML, Zhang CL. Mol Neurodegener. 2020 Oct 21;15(1):61. doi: 10.1186/s13024-020-00411-6. 10.1186/s13024-020-00411-6 PubMed 33087140