-
PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 and EMX1 expression, puromycin selection, BFP (See note in Depositor Comments section below)
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182312 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 13225
- Total vector size (bp) 14935
-
Modifications to backboneCAG-rtTA3G-polyA
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer ccgtaccacttcctaccctc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuro-T2A-mycNLS-mTagBFP2
-
Insert Size (bp)1326
- Promoter EF1a
-
Tag
/ Fusion Protein
- T2A-mycNLS-mTagBFP2
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site N/A (unknown if destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMichael Ward lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositing laboratory recommends that users discontinue use of this plasmid as they have found that the plasmid performs sub-optimally in the intended application. Please reach out to the depositing lab for further information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TO-NGN2-EMX1 puro-BFP was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 182312)