Skip to main content

pGW-Dronpa-Cav1.2
(Plasmid #182333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182333 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGW1
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 12000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cav1.2-Dronpa
  • Alt name
    CACNA1C
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7194
  • Mutation
    T1066Y, Q1070M
  • Entrez Gene
    CACNA1C (a.k.a. CACB, CaV1.2)
  • Promoter CMV
  • Tag / Fusion Protein
    • Full-length rabbit Cav1.2. (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CCGCACAAGGCCGTGGCGGTAGGG
  • 3′ sequencing primer SV40pA reverse
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGW-Dronpa-Cav1.2 was a gift from Jin Zhang (Addgene plasmid # 182333 ; http://n2t.net/addgene:182333 ; RRID:Addgene_182333)
  • For your References section:

    DrFLINC Contextualizes Super-resolution Activity Imaging. Lin W, Mo GCH, Mehta S, Zhang J. J Am Chem Soc. 2021 Sep 22;143(37):14951-14955. doi: 10.1021/jacs.1c05530. Epub 2021 Sep 13. 10.1021/jacs.1c05530 PubMed 34516108

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More