pAAV2-mtIF3 shRNA_TagRFP657
(Plasmid
#182367)
-
PurposeshRNA targeting mtIF3 mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV2
- Backbone size w/o insert (bp) 5813
- Total vector size (bp) 5869
-
Modifications to backboneTagRFP657 expression from separated promoter
-
Vector typeMammalian Expression, AAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemtIF3
-
gRNA/shRNA sequenceCCACGTTCAAGTCACGATAAAGA
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001256101.1
-
Entrez GeneMtif3 (a.k.a. 2810012L14Rik, AI414549)
- Promoter U6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site XbaI (destroyed during cloning)
- 5′ sequencing primer GGG CAG GAA GAG GGC CTA T (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV2-mtIF3 shRNA_TagRFP657 was a gift from Chunghun Lim (Addgene plasmid # 182367 ; http://n2t.net/addgene:182367 ; RRID:Addgene_182367) -
For your References section:
mtIF3 is locally translated in axons and regulates mitochondrial translation for axonal growth. Lee S, Park D, Lim C, Kim JI, Min KT. BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w. 10.1186/s12915-021-01215-w PubMed 34996455