Skip to main content

psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1
(Plasmid #182380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182380 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psiCheck2
  • Backbone size w/o insert (bp) 3386
  • Total vector size (bp) 5201
  • Modifications to backbone
    Changed HSV TK promoter to CMV promoter
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mtIF3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    903
  • Mutation
    Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant)
  • GenBank ID
    NM_001256101.1
  • Entrez Gene
    Mtif3 (a.k.a. 2810012L14Rik, AI414549)
  • Promoter SV40 promoter
  • Tag / Fusion Protein
    • 3xFlag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AATACGACTCACTATAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mito-mTFP1
  • Species
    Synthetic
  • Insert Size (bp)
    912
  • Promoter CMV promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTGTGTTGGTTTTTTGTGTG
  • 3′ sequencing primer AAATAAAGCAATAGCATCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1 was a gift from Chunghun Lim (Addgene plasmid # 182380 ; http://n2t.net/addgene:182380 ; RRID:Addgene_182380)
  • For your References section:

    mtIF3 is locally translated in axons and regulates mitochondrial translation for axonal growth. Lee S, Park D, Lim C, Kim JI, Min KT. BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w. 10.1186/s12915-021-01215-w PubMed 34996455