CAN1 gRNA HIS
              
              
                (Plasmid
                
                #182521)
              
            
            
            
          - 
            PurposeExpression vector for gRNA directed against CAN1 ORF.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRS413
 - Total vector size (bp) 6161
 - 
              Vector typeYeast Expression
 - 
                Selectable markersHIS3
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameCAN1 gRNA
 - 
                    gRNA/shRNA sequenceGATACGTTCTCTATGGAGGA
 - 
                    SpeciesS. cerevisiae (budding yeast)
 - 
                        Entrez GeneCAN1 (a.k.a. YEL063C)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
CAN1 gRNA HIS was a gift from Rob Mitra (Addgene plasmid # 182521 ; http://n2t.net/addgene:182521 ; RRID:Addgene_182521) - 
                
For your References section:
A Suite of New Strain Construction Vectors for Gene Expression Knockdown in Budding Yeast. Shively CA, Dong F, Mitra RD. ACS Synth Biol. 2023 Jan 17. doi: 10.1021/acssynbio.2c00547. 10.1021/acssynbio.2c00547 PubMed 36650116