pDRF1-GW AKAR3-EV
(Plasmid
#182533)
-
PurposeExpresses the PKA FRET sensor AKAR3-EV in budding yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDRF1-GW
- Total vector size (bp) 9156
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAKAR3-EV
-
SpeciesSynthetic
- Promoter PMA1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer AACAATCGTTAATAATTAATTAATTGG
- 3′ sequencing primer GAGTCACTTTAAAATTTGTATACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Miyazaki and Kazuhiro AOKI
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AKAR3-EV is obtained from https://doi.org/10.1091/mbc.e11-01-0072.
Please visit https://doi.org/10.1101/2022.10.27.514151 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRF1-GW AKAR3-EV was a gift from Bas Teusink (Addgene plasmid # 182533 ; http://n2t.net/addgene:182533 ; RRID:Addgene_182533) -
For your References section:
Using the AKAR3-EV biosensor to assess Sch9p- and PKA-signalling in budding yeast. Botman D, Kanagasabapathi S, Savakis P, Teusink B. FEMS Yeast Res. 2023 Jan 4;23:foad029. doi: 10.1093/femsyr/foad029. 10.1093/femsyr/foad029 PubMed 37173282