CAG-Mermaid in Tol2
(Plasmid #182578)

• Purpose: Expresses the FRET membrane voltage sensor Mermaid in vertebrate cells
• Depositing Lab: Andreas Stuermer
• Publication: CAG-Mermaid in Tol2 (unpublished)

Backbone

• Vector backbone: pUC57
• Backbone size w/o insert (bp): 2000
• Vector type: Mammalian Expression ; Zebrafish Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CAG-Mermaid in Tol2
• Species: Synthetic
• Insert Size (bp): 4007
• Promoter: CAG

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CTCCGAAAGTTTCCTTTTATGG
• 3′ sequencing primer: TAGTGGTGTCCAGAAAAGACC

Resource Information

• Supplemental Documents:
  • CAG-mermaid in Tol2 neater 720153.gb
• A portion of this plasmid was derived from a plasmid made by: Source of the DNA (coding sequence) is https://dnaconda.riken.jp/search/RDB_clone/RDB15/RDB15262.html and subsequently it was synthesized including the CAG promoter and tol2 sites

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Protein sequence of the Mermaid fluorescent voltage-sensing membrane protein was taken from https://dnaconda.riken.jp/search/RDB_clone/RDB15/RDB15262.html . The plasmid insert including CAG Promoter, terminator, and Tol2 sites has been synthesized and subcloned into pUC57.
Submitted to Addgene with kind permission of Dr. Tsutsui