CAG-Mermaid in Tol2
(Plasmid
#182578)
-
PurposeExpresses the FRET membrane voltage sensor Mermaid in vertebrate cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC57
- Backbone size w/o insert (bp) 2000
-
Vector typeMammalian Expression ; Zebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAG-Mermaid in Tol2
-
SpeciesSynthetic
-
Insert Size (bp)4007
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTCCGAAAGTTTCCTTTTATGG
- 3′ sequencing primer TAGTGGTGTCCAGAAAAGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySource of the DNA (coding sequence) is https://dnaconda.riken.jp/search/RDB_clone/RDB15/RDB15262.html and subsequently it was synthesized including the CAG promoter and tol2 sites
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Protein sequence of the Mermaid fluorescent voltage-sensing membrane protein was taken from https://dnaconda.riken.jp/search/RDB_clone/RDB15/RDB15262.html . The plasmid insert including CAG Promoter, terminator, and Tol2 sites has been synthesized and subcloned into pUC57.
Submitted to Addgene with kind permission of Dr. Tsutsui
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-Mermaid in Tol2 was a gift from Andreas Stuermer (Addgene plasmid # 182578 ; http://n2t.net/addgene:182578 ; RRID:Addgene_182578)