Skip to main content

CAG-Mermaid in Tol2
(Plasmid #182578)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182578 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57
  • Backbone size w/o insert (bp) 2000
  • Vector type
    Mammalian Expression ; Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAG-Mermaid in Tol2
  • Species
    Synthetic
  • Insert Size (bp)
    4007
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTCCGAAAGTTTCCTTTTATGG
  • 3′ sequencing primer TAGTGGTGTCCAGAAAAGACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Source of the DNA (coding sequence) is https://dnaconda.riken.jp/search/RDB_clone/RDB15/RDB15262.html and subsequently it was synthesized including the CAG promoter and tol2 sites

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Protein sequence of the Mermaid fluorescent voltage-sensing membrane protein was taken from https://dnaconda.riken.jp/search/RDB_clone/RDB15/RDB15262.html . The plasmid insert including CAG Promoter, terminator, and Tol2 sites has been synthesized and subcloned into pUC57.
Submitted to Addgene with kind permission of Dr. Tsutsui

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-Mermaid in Tol2 was a gift from Andreas Stuermer (Addgene plasmid # 182578 ; http://n2t.net/addgene:182578 ; RRID:Addgene_182578)