pQCXIP-cathepsinD-YMH
(Plasmid #182644)

• Purpose: Mammalian expression vector encoding a protein fusion composed of human cathepsin D fused to to one tyrosine sulfation (TS) motif (Y), myc (M) and His6 (H) epitope
• Depositing Lab: Martin Spiess
• Publication: Buser et al Life Sci Alliance. 2022 Mar 21;5(7). pii: 5/7/e202101269. doi: 10.26508/lsa.202101269. Print 2022 Mar.

Backbone

• Vector backbone: pQCXIP
• Backbone manufacturer: Clontech/Takara Bio
• Backbone size w/o insert (bp): 7181
• Total vector size (bp): 8499
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cathepsinD
• Species: H. sapiens (human)
• Insert Size (bp): 621
• Promoter: CMV
• Tags / Fusion Proteins:
  • TS site from proCCK (C terminal on insert)
  • myc-tag (C terminal on insert)
  • His6-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: AAGCGGCTTCGGCCAGTAACGTTA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry