Lenti_EGFP-P2A-HAUS6_IRES_Blast
(Plasmid
#182886)
-
PurposeTransfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (WT full length)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTransfer vector for Lentivirus production
- Total vector size (bp) 13235
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHAUS 6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2868
-
Entrez GeneHAUS6 (a.k.a. Dgt6, FAM29A)
- Promoter EF1alpha core
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CAAGTGTATGGCCAGATCTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti_EGFP-P2A-HAUS6_IRES_Blast was a gift from Daniel Gerlich (Addgene plasmid # 182886 ; http://n2t.net/addgene:182886 ; RRID:Addgene_182886) -
For your References section:
Augmin accumulation on long-lived microtubules drives amplification and kinetochore-directed growth. David AF, Roudot P, Legant WR, Betzig E, Danuser G, Gerlich DW. J Cell Biol. 2019 Jul 1;218(7):2150-2168. doi: 10.1083/jcb.201805044. Epub 2019 May 21. 10.1083/jcb.201805044 PubMed 31113824