Skip to main content

hSOD1-FLAG
(Plasmid #182922)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182922 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1+/C-(K)-DYK
  • Backbone size w/o insert (bp) 5444
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    [Cu-Zn] Superoxide dismutase 1
  • Alt name
    SOD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    462
  • GenBank ID
    OHu24018D
  • Entrez Gene
    SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGGAGGTCTATATAAGCAGAG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthesized by GenScript Biotech.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSOD1-FLAG was a gift from Philip Eaton (Addgene plasmid # 182922 ; http://n2t.net/addgene:182922 ; RRID:Addgene_182922)
  • For your References section:

    SOD1 is an essential H(2)S detoxifying enzyme. Switzer CH, Kasamatsu S, Ihara H, Eaton P. Proc Natl Acad Sci U S A. 2023 Jan 17;120(3):e2205044120. doi: 10.1073/pnas.2205044120. Epub 2023 Jan 11. 10.1073/pnas.2205044120 PubMed 36630448