pEGFPN1-ATG9A
(Plasmid
#198529)
-
PurposeExpression of ATG9A-GFP fusion protein in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198529 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 7250
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATG9A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2517
-
Mutationsilent mutations in codons 4 and 775
-
Entrez GeneATG9A (a.k.a. APG9L1, MGD3208, mATG9)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer pEGFP-N forward: 5’ CATTGACGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer pEGFP-N reverse: 5’ GTGGCCGTTTACGTCGCCGTCCAGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFPN1-ATG9A was a gift from Juan Bonifacino (Addgene plasmid # 198529 ; http://n2t.net/addgene:198529 ; RRID:Addgene_198529) -
For your References section:
AP-4 mediates export of ATG9A from the trans-Golgi network to promote autophagosome formation. Mattera R, Park SY, De Pace R, Guardia CM, Bonifacino JS. Proc Natl Acad Sci U S A. 2017 Dec 12;114(50):E10697-E10706. doi: 10.1073/pnas.1717327114. Epub 2017 Nov 27. 10.1073/pnas.1717327114 PubMed 29180427