-
Purposealpha7 nACHR expression in mammalian cell lines with calcium reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonesynthesized
-
Backbone manufacturerVectorbuilder
- Total vector size (bp) 8636
-
Modifications to backboneEF1 alpha promoter driving NACH7_IRES_Nacho, CMV promoter driving GCAMP7s-CAAX
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNACH7
-
Alt namealpha7 nicotinic acetylcholine receptor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1509
-
Entrez GeneCHRNA7 (a.k.a. CHRNA7-2, NACHRA7, nAChR7)
- Promoter EF1alpha
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysynthesized based on Genbank Sequence
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Human NACH7 expression plasmid coexpressing mouse NACHO chaperone protein for mammalian expression of alpha7 nicotinic acetylcholine receptors in mammalian cells. The plasmid contains the membrane targeted (CAAX sequence) GCAMP7s calcium reporter to detect NACH7 mediated calcium influx.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
alpha7nACHR_Nacho_GCAMP7s was a gift from Robert Brenner (Addgene plasmid # 182940 ; http://n2t.net/addgene:182940 ; RRID:Addgene_182940) -
For your References section:
Dequalinium chloride is an antagonists of alpha7 nicotinic acetylcholine receptors. Belanger-Coast MG, Zhang M, Bugay V, Gutierrez RA, Gregory SR, Yu W, Brenner R. Eur J Pharmacol. 2022 Jun 15;925:175000. doi: 10.1016/j.ejphar.2022.175000. Epub 2022 May 4. 10.1016/j.ejphar.2022.175000 PubMed 35525312