Skip to main content
Addgene

pDY281
(Plasmid #182960)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182960 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CoEi*
  • Total vector size (bp) 2000
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA (acctggtgaagccaatattc), homologous repair template for ptsI
  • Species
    E. coli
  • Insert Size (bp)
    500

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagggcgacacggaaatgttgaatactc
  • 3′ sequencing primer not applicable
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDY281 was a gift from Shelley Copley (Addgene plasmid # 182960 ; http://n2t.net/addgene:182960 ; RRID:Addgene_182960)
  • For your References section:

    Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Yang DD, Rusch LM, Widney KA, Morgenthaler AB, Copley SD. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22. 10.1073/pnas.2316834121 PubMed 38252823