pDY281
(Plasmid
#182960)
-
PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCoEi*
- Total vector size (bp) 2000
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA (acctggtgaagccaatattc), homologous repair template for ptsI
-
SpeciesE. coli
-
Insert Size (bp)500
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ataagggcgacacggaaatgttgaatactc
- 3′ sequencing primer not applicable
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDY281 was a gift from Shelley Copley (Addgene plasmid # 182960 ; http://n2t.net/addgene:182960 ; RRID:Addgene_182960) -
For your References section:
Synonymous edits in the Escherichia coli genome have substantial and condition-dependent effects on fitness. Yang DD, Rusch LM, Widney KA, Morgenthaler AB, Copley SD. Proc Natl Acad Sci U S A. 2024 Jan 30;121(5):e2316834121. doi: 10.1073/pnas.2316834121. Epub 2024 Jan 22. 10.1073/pnas.2316834121 PubMed 38252823