pLenti_EF1a_Flag_TP53_P278A
(Plasmid #183113)

• Purpose: Expresses flag-tagged p53 with P278A mutation in mammalian cells
• Depositing Lab: William Kaelin
• Publication: Stransky et al Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31.

Backbone

• Vector backbone: pLenti-EF1α-Gate-PGK-hygromycin
• Backbone manufacturer: Gift
• Backbone size w/o insert (bp): 10053
• Total vector size (bp): 11232
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TP53
• Alt name: LFS1, Cellular Tumor Antigen P53
• Species: H. sapiens (human)
• Insert Size (bp): 1179
• Mutation: changed proline 278 to alanine, see depositor comments below
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
• Promoter: EF1a
• Tag / Fusion Protein:
  • FLAG

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: 3' EF1a-fwd: CTTCCATTTCAGGTGTCGTG
• 3′ sequencing primer: 3' PGK-rev: CTTTTGAAGCGTGCAGAATG

Resource Information

• Supplemental Documents:
  • pLenti_EF1a_Flag_TP53_P278A_CRISPRres_PGK_Hygro.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: plasmid contains the P72R mutation from a common germline SNP in TP53.