pLenti_EF1a_Flag_TP53_R248W+P278A
(Plasmid
#183115)
-
PurposeExpresses flag-tagged p53 with both R248W and P278A mutations in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183115 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-EF1α-Gate-PGK-hygromycin
- Backbone size w/o insert (bp) 10053
- Total vector size (bp) 11232
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTP53
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1179
-
Mutationchanged proline 278 to alanine and arginine 248 to tryptophan, see depositor's comments below
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter EF1a
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 3' EF1a-fwd: CTTCCATTTCAGGTGTCGTG
- 3′ sequencing primer 3' PGK-rev: CTTTTGAAGCGTGCAGAATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: plasmid contains the P72R mutation from a common germline SNP in TP53.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_EF1a_Flag_TP53_R248W+P278A was a gift from William Kaelin (Addgene plasmid # 183115 ; http://n2t.net/addgene:183115 ; RRID:Addgene_183115) -
For your References section:
Sensitivity of VHL mutant kidney cancers to HIF2 inhibitors does not require an intact p53 pathway. Stransky LA, Vigeant SM, Huang B, West D, Denize T, Walton E, Signoretti S, Kaelin WG Jr. Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31. 10.1073/pnas.2120403119 PubMed 35357972