pBK086
(Plasmid
#183145)
-
PurposepET-6xHis-MBP-TEV-MapTIR-APAZ/MapAgo - Heterolgous MapSPARTA expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET-His6-MBP-TEV-LIC cloning vector (1M)
-
Backbone manufacturerScott Gradia
- Backbone size w/o insert (bp) 6465
- Total vector size (bp) 9397
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMapSPARTA operon (6xHis-MBP-MapTIR-APAZ and MapAgo)
-
Alt name6xHis-MBP-MapTIR-APAZ
-
Alt nameMapAgo
-
SpeciesMaribacter polysiphoniae DSM 23514
-
Insert Size (bp)4062
-
GenBank IDWP_109649956.1 WP_109649955.1
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatgaagccctgaaagacgcgcag
- 3′ sequencing primer tttgttagcagccggatctcag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK086 was a gift from Daan Swarts (Addgene plasmid # 183145 ; http://n2t.net/addgene:183145 ; RRID:Addgene_183145) -
For your References section:
Short prokaryotic Argonaute systems trigger cell death upon detection of invading DNA. Koopal B, Potocnik A, Mutte SK, Aparicio-Maldonado C, Lindhoud S, Vervoort JJM, Brouns SJJ, Swarts DC. Cell. 2022 Apr 28;185(9):1471-1486.e19. doi: 10.1016/j.cell.2022.03.012. Epub 2022 Apr 4. 10.1016/j.cell.2022.03.012 PubMed 35381200