Skip to main content

pLentiCRISPR_zeo_sgTP53
(Plasmid #183180)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183180 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Backbone size w/o insert (bp) 12767
  • Total vector size (bp) 12787
  • Modifications to backbone
    Modified to replace PuroR gene with BleoR gene
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgTP53
  • gRNA/shRNA sequence
    CCATTGTTCAATATCGTCCG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1179
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BSMBI (unknown if destroyed)
  • 3′ cloning site BSMBI (unknown if destroyed)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPR_zeo_sgTP53 was a gift from William Kaelin (Addgene plasmid # 183180 ; http://n2t.net/addgene:183180 ; RRID:Addgene_183180)
  • For your References section:

    Sensitivity of VHL mutant kidney cancers to HIF2 inhibitors does not require an intact p53 pathway. Stransky LA, Vigeant SM, Huang B, West D, Denize T, Walton E, Signoretti S, Kaelin WG Jr. Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31. 10.1073/pnas.2120403119 PubMed 35357972