pLentiCRISPR_zeo_sgNT135
(Plasmid
#183181)
-
PurposepLentiCRISPR that is selectable with zeocin with a non-targeting sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiCRISPRv2
- Backbone size w/o insert (bp) 12767
- Total vector size (bp) 12787
-
Modifications to backboneModified to replace PuroR gene with BleoR gene
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNT135
-
Alt nameNon-Targeting Guide
-
gRNA/shRNA sequenceCGCTTCCGCGGCCCGTTCAA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BSMBI (unknown if destroyed)
- 3′ cloning site BSMBI (unknown if destroyed)
- 5′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR_zeo_sgNT135 was a gift from William Kaelin (Addgene plasmid # 183181 ; http://n2t.net/addgene:183181 ; RRID:Addgene_183181) -
For your References section:
Sensitivity of VHL mutant kidney cancers to HIF2 inhibitors does not require an intact p53 pathway. Stransky LA, Vigeant SM, Huang B, West D, Denize T, Walton E, Signoretti S, Kaelin WG Jr. Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31. 10.1073/pnas.2120403119 PubMed 35357972